generation transfer plasmid plko 1 trc cloning vector (Addgene inc)
Addgene inc is a verified supplier 
96
Structured Review
Addgene inc
generation transfer plasmid plko 1 trc cloning vector
Generation Transfer Plasmid Plko 1 Trc Cloning Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1298 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/generation+transfer+plasmid+plko+1+trc+cloning+vector/pLKO%2E1+-+TRC+cloning+vector+(Plasmid+%2310878)/bio_rxiv__2024__06__29__601287-313-9-15
Average 96 stars, based on 1298 article reviews
Generation Transfer Plasmid Plko 1 Trc Cloning Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1298 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/generation+transfer+plasmid+plko+1+trc+cloning+vector/pLKO%2E1+-+TRC+cloning+vector+(Plasmid+%2310878)/bio_rxiv__2024__06__29__601287-313-9-15
Average 96 stars, based on 1298 article reviews
generation transfer plasmid plko 1 trc cloning vector - by Bioz Stars,
2026-10
96/100 stars
Images
Related Articles
shRNA:Article Title: Membrane Curvature Promotes ER-PM Contact Formation via Junctophilin-EHD Interactions Article Snippet: .. shRNA coding sequences were cloned and inserted into 3rd Article Title: PERK arm of UPR selectively regulates ferroptosis in colon cancer cells by modulating the expression of SLC7A11 (System Xc-) Article Snippet: .. For PERK, SLC7A11 , and ATF4 knockdown generation, shRNA sequences were cloned into the 3rd Article Title: Loss of PERK function promotes ferroptosis by downregulating SLC7A11 (System Xc⁻) in colorectal cancer Article Snippet: .. For PERK, SLC7A11 , and ATF4 knockdown generation, shRNA sequences were cloned into the 3rd Article Title: Loss of PERK function promotes ferroptosis by downregulating SLC7A11 (System Xc⁻) in colorectal cancer. Article Snippet: .. For PERK, SLC7A11, and ATF4 knockdown generation, shRNA sequences were cloned into the 3rd Article Title: CXCR4 intracellular protein regulates drug resistance and tumorigenic potential via modulating the expression of Death Receptor 5 Article Snippet: .. CXCR4 shRNA Sequence: 5’CCGGTCCTGTCCTGCTATTGCATTACTCGAGTAATGCAATAGCAGGACAGGATTTTTG 3’ was cloned into the 3rd Article Title: EZH2-H3K27me3 mediated KRT14 upregulation promotes TNBC peritoneal metastasis Article Snippet: .. Following the same protocol reported in our recent publication EZH2 mouse, KRT14 mouse, and Human shRNA, SP1 mouse, and human and UTX mouse shRNA sequence were cloned in the 3rd Article Title: H3K27me3 mediated KRT14 upregulation promotes TNBC peritoneal metastasis Article Snippet: .. EZH2 mouse, KRT14 mouse and Human ShRNA sequence were cloned in the 3rd Article Title: CXCR4 intracellular protein promotes drug resistance and tumorigenic potential by inversely regulating the expression of Death Receptor 5 Article Snippet: .. CXCR4 shRNA Sequence: 5ʹCCGGTCCTGTCCTGCTATTGCATTACTCGAGTAATGCAATAGCAGGACAGGATTTTTG3ʹ was cloned into the 3rd Clone Assay:Article Title: Membrane Curvature Promotes ER-PM Contact Formation via Junctophilin-EHD Interactions Article Snippet: .. shRNA coding sequences were cloned and inserted into 3rd Article Title: PERK arm of UPR selectively regulates ferroptosis in colon cancer cells by modulating the expression of SLC7A11 (System Xc-) Article Snippet: .. For PERK, SLC7A11 , and ATF4 knockdown generation, shRNA sequences were cloned into the 3rd Article Title: Loss of PERK function promotes ferroptosis by downregulating SLC7A11 (System Xc⁻) in colorectal cancer Article Snippet: .. For PERK, SLC7A11 , and ATF4 knockdown generation, shRNA sequences were cloned into the 3rd Article Title: Loss of PERK function promotes ferroptosis by downregulating SLC7A11 (System Xc⁻) in colorectal cancer. Article Snippet: .. For PERK, SLC7A11, and ATF4 knockdown generation, shRNA sequences were cloned into the 3rd Article Title: CXCR4 intracellular protein regulates drug resistance and tumorigenic potential via modulating the expression of Death Receptor 5 Article Snippet: .. CXCR4 shRNA Sequence: 5’CCGGTCCTGTCCTGCTATTGCATTACTCGAGTAATGCAATAGCAGGACAGGATTTTTG 3’ was cloned into the 3rd Article Title: EZH2-H3K27me3 mediated KRT14 upregulation promotes TNBC peritoneal metastasis Article Snippet: .. Following the same protocol reported in our recent publication EZH2 mouse, KRT14 mouse, and Human shRNA, SP1 mouse, and human and UTX mouse shRNA sequence were cloned in the 3rd Article Title: H3K27me3 mediated KRT14 upregulation promotes TNBC peritoneal metastasis Article Snippet: .. EZH2 mouse, KRT14 mouse and Human ShRNA sequence were cloned in the 3rd Article Title: CXCR4 intracellular protein promotes drug resistance and tumorigenic potential by inversely regulating the expression of Death Receptor 5 Article Snippet: .. CXCR4 shRNA Sequence: 5ʹCCGGTCCTGTCCTGCTATTGCATTACTCGAGTAATGCAATAGCAGGACAGGATTTTTG3ʹ was cloned into the 3rd Plasmid Preparation:Article Title: Membrane Curvature Promotes ER-PM Contact Formation via Junctophilin-EHD Interactions Article Snippet: .. shRNA coding sequences were cloned and inserted into 3rd Article Title: PERK arm of UPR selectively regulates ferroptosis in colon cancer cells by modulating the expression of SLC7A11 (System Xc-) Article Snippet: .. For PERK, SLC7A11 , and ATF4 knockdown generation, shRNA sequences were cloned into the 3rd Article Title: Loss of PERK function promotes ferroptosis by downregulating SLC7A11 (System Xc⁻) in colorectal cancer Article Snippet: .. For PERK, SLC7A11 , and ATF4 knockdown generation, shRNA sequences were cloned into the 3rd Article Title: Loss of PERK function promotes ferroptosis by downregulating SLC7A11 (System Xc⁻) in colorectal cancer. Article Snippet: .. For PERK, SLC7A11, and ATF4 knockdown generation, shRNA sequences were cloned into the 3rd Article Title: CXCR4 intracellular protein regulates drug resistance and tumorigenic potential via modulating the expression of Death Receptor 5 Article Snippet: .. CXCR4 shRNA Sequence: 5’CCGGTCCTGTCCTGCTATTGCATTACTCGAGTAATGCAATAGCAGGACAGGATTTTTG 3’ was cloned into the 3rd Article Title: EZH2-H3K27me3 mediated KRT14 upregulation promotes TNBC peritoneal metastasis Article Snippet: .. Following the same protocol reported in our recent publication EZH2 mouse, KRT14 mouse, and Human shRNA, SP1 mouse, and human and UTX mouse shRNA sequence were cloned in the 3rd Article Title: H3K27me3 mediated KRT14 upregulation promotes TNBC peritoneal metastasis Article Snippet: .. EZH2 mouse, KRT14 mouse and Human ShRNA sequence were cloned in the 3rd Article Title: CXCR4 intracellular protein promotes drug resistance and tumorigenic potential by inversely regulating the expression of Death Receptor 5 Article Snippet: .. CXCR4 shRNA Sequence: 5ʹCCGGTCCTGTCCTGCTATTGCATTACTCGAGTAATGCAATAGCAGGACAGGATTTTTG3ʹ was cloned into the 3rd Cloning:Article Title: Membrane Curvature Promotes ER-PM Contact Formation via Junctophilin-EHD Interactions Article Snippet: .. shRNA coding sequences were cloned and inserted into 3rd Article Title: PERK arm of UPR selectively regulates ferroptosis in colon cancer cells by modulating the expression of SLC7A11 (System Xc-) Article Snippet: .. For PERK, SLC7A11 , and ATF4 knockdown generation, shRNA sequences were cloned into the 3rd Article Title: Loss of PERK function promotes ferroptosis by downregulating SLC7A11 (System Xc⁻) in colorectal cancer Article Snippet: .. For PERK, SLC7A11 , and ATF4 knockdown generation, shRNA sequences were cloned into the 3rd Article Title: Loss of PERK function promotes ferroptosis by downregulating SLC7A11 (System Xc⁻) in colorectal cancer. Article Snippet: .. For PERK, SLC7A11, and ATF4 knockdown generation, shRNA sequences were cloned into the 3rd Article Title: CXCR4 intracellular protein regulates drug resistance and tumorigenic potential via modulating the expression of Death Receptor 5 Article Snippet: .. CXCR4 shRNA Sequence: 5’CCGGTCCTGTCCTGCTATTGCATTACTCGAGTAATGCAATAGCAGGACAGGATTTTTG 3’ was cloned into the 3rd Article Title: EZH2-H3K27me3 mediated KRT14 upregulation promotes TNBC peritoneal metastasis Article Snippet: .. Following the same protocol reported in our recent publication EZH2 mouse, KRT14 mouse, and Human shRNA, SP1 mouse, and human and UTX mouse shRNA sequence were cloned in the 3rd Article Title: H3K27me3 mediated KRT14 upregulation promotes TNBC peritoneal metastasis Article Snippet: .. EZH2 mouse, KRT14 mouse and Human ShRNA sequence were cloned in the 3rd Article Title: CXCR4 intracellular protein promotes drug resistance and tumorigenic potential by inversely regulating the expression of Death Receptor 5 Article Snippet: .. CXCR4 shRNA Sequence: 5ʹCCGGTCCTGTCCTGCTATTGCATTACTCGAGTAATGCAATAGCAGGACAGGATTTTTG3ʹ was cloned into the 3rd Knockdown:Article Title: PERK arm of UPR selectively regulates ferroptosis in colon cancer cells by modulating the expression of SLC7A11 (System Xc-) Article Snippet: .. For PERK, SLC7A11 , and ATF4 knockdown generation, shRNA sequences were cloned into the 3rd Article Title: Loss of PERK function promotes ferroptosis by downregulating SLC7A11 (System Xc⁻) in colorectal cancer Article Snippet: .. For PERK, SLC7A11 , and ATF4 knockdown generation, shRNA sequences were cloned into the 3rd Article Title: Loss of PERK function promotes ferroptosis by downregulating SLC7A11 (System Xc⁻) in colorectal cancer. Article Snippet: .. For PERK, SLC7A11, and ATF4 knockdown generation, shRNA sequences were cloned into the 3rd Sequencing:Article Title: CXCR4 intracellular protein regulates drug resistance and tumorigenic potential via modulating the expression of Death Receptor 5 Article Snippet: .. CXCR4 shRNA Sequence: 5’CCGGTCCTGTCCTGCTATTGCATTACTCGAGTAATGCAATAGCAGGACAGGATTTTTG 3’ was cloned into the 3rd Article Title: EZH2-H3K27me3 mediated KRT14 upregulation promotes TNBC peritoneal metastasis Article Snippet: .. Following the same protocol reported in our recent publication EZH2 mouse, KRT14 mouse, and Human shRNA, SP1 mouse, and human and UTX mouse shRNA sequence were cloned in the 3rd Article Title: H3K27me3 mediated KRT14 upregulation promotes TNBC peritoneal metastasis Article Snippet: .. EZH2 mouse, KRT14 mouse and Human ShRNA sequence were cloned in the 3rd Article Title: CXCR4 intracellular protein promotes drug resistance and tumorigenic potential by inversely regulating the expression of Death Receptor 5 Article Snippet: .. CXCR4 shRNA Sequence: 5ʹCCGGTCCTGTCCTGCTATTGCATTACTCGAGTAATGCAATAGCAGGACAGGATTTTTG3ʹ was cloned into the 3rd |